ergic2

Ensembl ID:
ENSDARG00000051936
ZFIN ID:
ZDB-GENE-040426-1331
Description:
Endoplasmic reticulum-Golgi intermediate compartment protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7T2
Human Orthologue:
ERGIC2
Human Description:
ERGIC and golgi 2 [Source:HGNC Symbol;Acc:30208]
Mouse Orthologue:
Ergic2
Mouse Description:
ERGIC and golgi 2 Gene [Source:MGI Symbol;Acc:MGI:1914706]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44294 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073651 Essential Splice Site 124 376 6 14

The following transcripts of ENSDARG00000051936 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 21365272)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20620827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCAGGTTGTTTTTGACCTTTCTCCCCAGCAGCGGCTCTGGCACAGG[T/C]GAATTACATTTCATTCATTTTATATGTGTTTACAATTTCTAGCTTCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link