dok1b

Ensembl ID:
ENSDARG00000051935
ZFIN ID:
ZDB-GENE-040426-2063
Description:
docking protein 1 [Source:RefSeq peptide;Acc:NP_998253]
Human Orthologue:
DOK1
Human Description:
docking protein 1, 62kDa (downstream of tyrosine kinase 1) [Source:HGNC Symbol;Acc:2990]
Mouse Orthologue:
Dok1
Mouse Description:
docking protein 1 Gene [Source:MGI Symbol;Acc:MGI:893587]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1780 Essential Splice Site Available for shipment Available now
sa11397 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073650 Essential Splice Site 147 575 3 5
Genomic Location (Zv9):
Chromosome 7 (position 65753944)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58935684
KASP Assay ID:
554-1773.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGAGCTTCAAATGGCAGAAAATCTYATTTATTACTCCAGGGAAGAAG[G/A]TAAGAAGCAACARCGTGGCACAGTATGAATTTACAATACTCTGCTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073650 Essential Splice Site 148 575 3 5
Genomic Location (Zv9):
Chromosome 7 (position 65753945)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58935685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGCTTCAAATGGCAGAAAATCTYATTTATTACTCCAGGGAAGAAGR[T/G]AAGAAGCAACARCGTGGCACAGTATGAATTTACAATACTCTGCTATAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link