edc3

Ensembl ID:
ENSDARG00000051931
ZFIN IDs:
ZDB-GENE-050522-287, ZDB-GENE-050522-287
Description:
Enhancer of mRNA-decapping protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q502M5]
Human Orthologue:
EDC3
Human Description:
enhancer of mRNA decapping 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26114]
Mouse Orthologue:
Edc3
Mouse Description:
enhancer of mRNA decapping 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2142951]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24671 Nonsense Mutation detected in F1 DNA During 2014
sa24670 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067373 Nonsense 152 506 3 7
ENSDART00000130909 Nonsense 152 506 2 6
Genomic Location:
Chromosome 25 (position 21333929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACGGTGAACGTCACATAGATATGGCTGTACAGGGTAAAGGCTTTAGA[C/T]GAAGACACAACTCATGTGAGTCTTCTTAGTCGTATATCTATTTAGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067373 Nonsense 269 506 4 7
ENSDART00000130909 Nonsense 269 506 3 6
Genomic Location:
Chromosome 25 (position 21329133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCGTTTACAGACAGATCACAGTTCCACAGAATGGATCAAAAGAATA[T/A]AGCACTGGTAAGAATCAGAGCTGCACTATAAGAAAAAAATGGCGTTGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Caffeine consumption: Genome-wide meta-analysis identifies regions on 7p21 (AHR) and 15q24 (CYP1A2) as determinants of habitual caffeine consumption. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/samr1zbz