plag1

Ensembl ID:
ENSDARG00000051926
ZFIN ID:
ZDB-GENE-060302-2
Description:
pleiomorphic adenoma gene 1 [Source:RefSeq peptide;Acc:NP_001034903]
Human Orthologue:
PLAG1
Human Description:
pleiomorphic adenoma gene 1 [Source:HGNC Symbol;Acc:9045]
Mouse Orthologue:
Plag1
Mouse Description:
pleiomorphic adenoma gene 1 Gene [Source:MGI Symbol;Acc:MGI:1891916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9509 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073640 Nonsense 283 393 3 3
ENSDART00000127884 Nonsense 283 393 2 2
Genomic Location (Zv9):
Chromosome 7 (position 59984802)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58437411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAWGCCTCCTACTCACCACCGCCACCCTTGAGAGCAGAGCTTGAAAGTTA[T/G]CTTCTAGAGCTACAGGCTGAAGATACACCCAAGCTGAGTTCTTCCACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link