ccnb1

Ensembl ID:
ENSDARG00000051923
ZFIN ID:
ZDB-GENE-000406-10
Description:
G2/mitotic-specific cyclin-B1 [Source:RefSeq peptide;Acc:NP_571588]
Human Orthologue:
CCNB1
Human Description:
cyclin B1 [Source:HGNC Symbol;Acc:1579]
Mouse Orthologue:
Ccnb1
Mouse Description:
cyclin B1 Gene [Source:MGI Symbol;Acc:MGI:88302]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33717 Nonsense Mutation detected in F1 DNA During 2017
sa44618 Nonsense Mutation detected in F1 DNA During 2017
sa38506 Nonsense Mutation detected in F1 DNA During 2017
sa40559 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063357 Nonsense 32 398 2 9
Genomic Location (Zv9):
Chromosome 5 (position 55152627)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54091334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGAATCAGAACGCTCTGCCCGGAAAAGCAGTTGTAGCGAACAAGCCC[G/T]GACTCAGACCAAGGGCCGCGCTGGGGGAGATTGGCAACAATCCGCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063357 Nonsense 110 398 4 9
Genomic Location (Zv9):
Chromosome 5 (position 55151523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTCCTGTTCCTATGGAGACCTCCGGCTGTGCTTCAGATGATCTGTG[T/A]CAAGCATTCTCTGATGTTCTGCTTAATATCAAGGATGTTGACGCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063357 Nonsense 128 398 4 9
Genomic Location (Zv9):
Chromosome 5 (position 55151469)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54090176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCTCTGATGTTCTGCTTAATATCAAGGATGTTGACGCAGATGACTA[T/A]GATAATCCCATGCTTTGCAGTGAATATGTCAAGGACATCTATTTGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063357 Nonsense 225 398 6 9
Genomic Location (Zv9):
Chromosome 5 (position 55150872)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54089579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCTGCAACTTGTTGGTGTAACGGCCATGTTCATCGCCTCAAAATA[T/G]GAAGAGATGTACCCACCAGAGATTGCAGACTTTGCTTTTGTGACAGACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link