pde5ab

Ensembl ID:
ENSDARG00000051915
ZFIN ID:
ZDB-GENE-060824-4
Description:
cGMP-specific 3',5'-cyclic phosphodiesterase [Source:RefSeq peptide;Acc:NP_001116732]
Human Orthologue:
PDE5A
Human Description:
phosphodiesterase 5A, cGMP-specific [Source:HGNC Symbol;Acc:8784]
Mouse Orthologue:
Pde5a
Mouse Description:
phosphodiesterase 5A, cGMP-specific Gene [Source:MGI Symbol;Acc:MGI:2651499]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21102 Nonsense Available for shipment Available now
sa34205 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7093 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073625 Nonsense 328 868 5 21
ENSDART00000122676 Nonsense 319 858 6 22
ENSDART00000138188 Nonsense 328 867 5 21

The following transcripts of ENSDARG00000051915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58802453)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57255062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGCTACACAATGCCCAACTCTATGAGACATCACAGCTAGAGAACAGG[C/T]GAAACCAGGTATGCTGTTTCTTTGTAAGAAGTCAGTATATACAACCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073625 Essential Splice Site 522 868 None 21
ENSDART00000122676 Essential Splice Site 513 858 None 22
ENSDART00000138188 Essential Splice Site 522 867 None 21

The following transcripts of ENSDARG00000051915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58824373)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57276982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGAAGCAGTGGAAAGAGCAATGGCCAAGCAAGAGGTCACACTTGAGG[T/G]TAGTGTGCTAATCTATACCTTAATGAAACAAAAATAAAAAAAAAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073625 Essential Splice Site 754 868 17 21
ENSDART00000122676 Essential Splice Site 745 858 18 22
ENSDART00000138188 Essential Splice Site 753 867 17 21

The following transcripts of ENSDARG00000051915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58855799)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57308408
KASP Assay ID:
554-4215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACAGTCAGTTTGAATGGGAAGAYGATTGCCACAGGGATCTATTAAG[G/A]TGAGCATTCRGTYAATAAYGTAATGTGCTATTGTTTAGCTCACTGCNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link