prmt7

Ensembl ID:
ENSDARG00000051902
ZFIN ID:
ZDB-GENE-040426-1560
Description:
Protein arginine N-methyltransferase 7 [Source:UniProtKB/Swiss-Prot;Acc:A2AV36]
Human Orthologue:
PRMT7
Human Description:
protein arginine methyltransferase 7 [Source:HGNC Symbol;Acc:25557]
Mouse Orthologue:
Prmt7
Mouse Description:
protein arginine N-methyltransferase 7 Gene [Source:MGI Symbol;Acc:MGI:2384879]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa552 Essential Splice Site F2 line generated During 2017
sa44256 Nonsense Mutation detected in F1 DNA During 2017
sa38029 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa552
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073609 Essential Splice Site 44 683 2 17
Genomic Location (Zv9):
Chromosome 25 (position 14684530)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14327453
KASP Assay ID:
554-0462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTTTTTAGGTCTTGTTATGCAGATATGCTCCATGATAAAGACAGAG[T/A]GAGTATGATGTCGGACACATGCTAATATTACTGCTGGATCCAAAGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073609 Nonsense 215 683 6 17
Genomic Location (Zv9):
Chromosome 25 (position 14679938)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14322861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGATGTGGACGGGCACAGACTGATGCCCCCAGGGGCAGTTCAGGAGTG[T/A]GCAGGAGCGCCATCTGTCTGTGACATCCAGCTGAGTCAGGTGCCCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073609 Essential Splice Site 306 683 8 17
Genomic Location (Zv9):
Chromosome 25 (position 14676644)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14319567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTAAAAACAACTTGAATACATGTTTTTTTTGCATCATGTGATGTGCA[G/A]TGGAGGGATCACTGGATGCAGAGTGTCTACTTCCTTCCTGCAGAGGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Magnesium levels: Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link