si:ch211-51l3.1

Ensembl ID:
ENSDARG00000051899
ZFIN ID:
ZDB-GENE-061207-36
Description:
Exocyst complex component 3-like protein [Source:UniProtKB/Swiss-Prot;Acc:A2AV37]
Human Orthologue:
EXOC3L
Human Description:
exocyst complex component 3-like [Source:HGNC Symbol;Acc:27540]
Mouse Orthologue:
Exoc3l
Mouse Description:
exocyst complex component 3-like Gene [Source:MGI Symbol;Acc:MGI:3041195]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1667 Nonsense Available for shipment Available now
sa6799 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103957 Nonsense 142 780 3 13

The following transcripts of ENSDARG00000051899 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 14692368)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14335291
KASP Assay ID:
554-1614.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCTGTCAGTCACTGTCAGCTTCTTGCTGCAGTAAGCAACCTGCCT[C/T]GACTCTACAAAGGTTAGGGACTGCCCACTCATTATGCACATTATGTCTAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103957 Essential Splice Site 532 780 None 13

The following transcripts of ENSDARG00000051899 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 14690283)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14333206
KASP Assay ID:
554-4976.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACCTCCATTACCTCCTGGCCTGCATCAACAACTGCATCATTCTCAAG[T/C]GAGATGGTGTACAAGTATCTTTTTACAGTATGTCTGTATTTATGTGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link