fbn2a

Ensembl ID:
ENSDARG00000051896
ZFIN ID:
ZDB-GENE-090112-4
Description:
Fibrillin 4 [Source:UniProtKB/TrEMBL;Acc:B6D7H2]
Human Orthologues:
FBN1, FBN2, FBN3
Human Descriptions:
fibrillin 1 [Source:HGNC Symbol;Acc:3603]
fibrillin 2 [Source:HGNC Symbol;Acc:3604]
fibrillin 3 [Source:HGNC Symbol;Acc:18794]
Mouse Orthologues:
Fbn1, Fbn2
Mouse Descriptions:
fibrillin 1 Gene [Source:MGI Symbol;Acc:MGI:95489]
fibrillin 2 Gene [Source:MGI Symbol;Acc:MGI:95490]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17112 Nonsense Available for shipment Available now
sa34872 Nonsense Mutation detected in F1 DNA During 2016
sa31772 Nonsense Available for shipment Available now
sa41615 Nonsense Mutation detected in F1 DNA During 2016
sa21697 Essential Splice Site Available for shipment Available now
sa41614 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21696 Essential Splice Site Available for shipment Available now
sa34871 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21695 Essential Splice Site Available for shipment Available now
sa14555 Essential Splice Site Available for shipment Available now
sa34870 Nonsense Mutation detected in F1 DNA During 2016
sa14044 Nonsense Available for shipment Available now
sa27582 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 55 1850 3 45
Genomic Location (Zv9):
Chromosome 10 (position 16410386)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16501543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAACCACTGATTATATTTTTTTCTTCTGTTTTACTCTCTAAAGCCAAA[C/T]AATGCWAWAYAAGGTGTATGAATGGAGGAGTGTGTGAAGATGACTATTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 159 1850 5 45
Genomic Location (Zv9):
Chromosome 10 (position 16404253)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16495410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGGCCTTGTGCTGTGCCACAGTGGGTCAAGCGTGGGGTCACTCGTGC[G/T]AGCAGTGCCCACCTATCAGCTCGCCCTGCACCAGAGGGTTCATCCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 713 1850 17 45
Genomic Location (Zv9):
Chromosome 10 (position 16370068)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16461225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCGAGGAAATTTCCGCTGCGTCTGTAACATTGGCTATGAAAGTGAC[C/T]AGAGCGGCAGAAACTGTTTAGGTCAGTTGACATTTAATATAATTACTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 743 1850 18 45
Genomic Location (Zv9):
Chromosome 10 (position 16362989)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16454146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTCTCCTCTGTGATAATGGCCTGTGCCGGAATGTTCCAGGAAGCTA[C/A]AGTTGCACCTGCCCGGCGGGGTTCATCTTCAGACATGACACAGAGACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 865 1850 21 45
Genomic Location (Zv9):
Chromosome 10 (position 16356846)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16448003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTGTGCGAACGAGGATTTGCTCAGTCAAGAGGGGCTTCATGTGAAGG[T/C]GACAGTTTCATAGAAACGACTTTAACATAAACTCTGTTTTCTCTGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 906 1850 22 45
Genomic Location (Zv9):
Chromosome 10 (position 16356612)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16447769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGCCCAGAAAGCCTCACACTGGATGTCACTGGACGCCTCTGTGTTG[G/A]TAAACCACCCTAATTTTGTGTCAAAGTATAATTCAAAGTGTAATTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 983 1850 23 45
Genomic Location (Zv9):
Chromosome 10 (position 16355304)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16446461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCGCCAACAAAGGAGACGTTCTCACTGGCAGAGCTGTCTATAAAGG[T/G]CAAAAAGATTTTGATCTTTGATTTTGAATATTTAGCTTTTACTGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 1024 1850 24 45
ENSDART00000073604 Essential Splice Site 1024 1850 24 45
Genomic Location (Zv9):
Chromosome 10 (position 16355056)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16446213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGTGATAGTGGATTTGCACTGGATACCAATGAGAAAAACTGCACAG[G/A]TAAAACAAATCATTTTCATTACACCATGCATTTACAGTATGATGATAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 1024 1850 24 45
ENSDART00000073604 Essential Splice Site 1024 1850 24 45
Genomic Location (Zv9):
Chromosome 10 (position 16355056)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16446213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGTGATAGTGGATTTGCACTGGATACCAATGAGAAAAACTGCACAG[G/A]TAAAACAAATCATTTTCATTACACCATGCATTTACAGTATGATGATAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 1110 1850 26 45
Genomic Location (Zv9):
Chromosome 10 (position 16350456)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16441613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCCGCCTGGTCATCATCTGTCTGTGGATGGCAGTGCCTGTGAAGG[T/G]GAACTAAATCATGTCMTTTGTGTGGGCTATATCTCACTCTTGTTTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 1572 1850 38 45
Genomic Location (Zv9):
Chromosome 10 (position 16308838)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16400096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTCAGATATCGATGAGTGTCAGGAGCTGCCCGGCGTCTGTCAGGGT[G/T]GAAACTGTGTTAACACATTCGGAAGTTTCCAGTGTGAATGTCCAGCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 1617 1850 39 45
Genomic Location (Zv9):
Chromosome 10 (position 16306972)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16398230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGATGAGTGTGTGCTCAGTTTGGGGGTTTGTGGTCCAGGCACCTGCTA[C/A]AACACACTGGGAAACTACACTTGTGTCTGTCCACARGAWTACATTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 1627 1850 39 45
Genomic Location (Zv9):
Chromosome 10 (position 16306942)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16398200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGTCCAGGCACCTGCTACAACACACTGGGAAACTACACTTGTGTCTG[T/A]CCACAAGATTACATTCAGGTGAATGGAGGACACAGATGCATGGGTGAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link