fbn2a

Ensembl ID:
ENSDARG00000051896
ZFIN ID:
ZDB-GENE-090112-4
Description:
Fibrillin 4 [Source:UniProtKB/TrEMBL;Acc:B6D7H2]
Human Orthologues:
FBN1, FBN2, FBN3
Human Descriptions:
fibrillin 1 [Source:HGNC Symbol;Acc:3603]
fibrillin 2 [Source:HGNC Symbol;Acc:3604]
fibrillin 3 [Source:HGNC Symbol;Acc:18794]
Mouse Orthologues:
Fbn1, Fbn2
Mouse Descriptions:
fibrillin 1 Gene [Source:MGI Symbol;Acc:MGI:95489]
fibrillin 2 Gene [Source:MGI Symbol;Acc:MGI:95490]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17112 Nonsense Available for shipment Available now
sa3770 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21697 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21696 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21695 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14555 Essential Splice Site Available for shipment Available now
sa14044 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 55 1850 3 45
Genomic Location:
Chromosome 10 (position 16410386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAACCACTGATTATATTTTTTTCTTCTGTTTTACTCTCTAAAGCCAAA[C/T]AATGCWAWAYAAGGTGTATGAATGGAGGAGTGTGTGAAGATGACTATTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 568 1850 13 45
Genomic Location:
Chromosome 10 (position 16385104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTAAACCTGGATTCACCCTCAACTCTAGTGGACGATACTGTACAGG[T/C]GAACACTGCTATTCCTCTATTGTTTCTTAAAATAATAATAATAAATTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 865 1850 21 45
Genomic Location:
Chromosome 10 (position 16356846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTGTGCGAACGAGGATTTGCTCAGTCAAGAGGGGCTTCATGTGAAGG[T/C]GACAGTTTCATAGAAACGACTTTAACATAAACTCTGTTTTCTCTGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 983 1850 23 45
Genomic Location:
Chromosome 10 (position 16355304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCGCCAACAAAGGAGACGTTCTCACTGGCAGAGCTGTCTATAAAGG[T/G]CAAAAAGATTTTGATCTTTGATTTTGAATATTTAGCTTTTACTGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 1024 1850 24 45
Genomic Location:
Chromosome 10 (position 16355056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGTGATAGTGGATTTGCACTGGATACCAATGAGAAAAACTGCACAG[G/A]TAAAACAAATCATTTTCATTACACCATGCATTTACAGTATGATGATAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Essential Splice Site 1110 1850 26 45
Genomic Location:
Chromosome 10 (position 16350456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCCGCCTGGTCATCATCTGTCTGTGGATGGCAGTGCCTGTGAAGG[T/G]GAACTAAATCATGTCMTTTGTGTGGGCTATATCTCACTCTTGTTTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073604 Nonsense 1617 1850 39 45
Genomic Location:
Chromosome 10 (position 16306972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGATGAGTGTGTGCTCAGTTTGGGGGTTTGTGGTCCAGGCACCTGCTA[C/A]AACACACTGGGAAACTACACTTGTGTCTGTCCACARGAWTACATTCAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wqv9bpix