LOC566228

Ensembl ID:
ENSDARG00000051892
Human Orthologue:
KCNG4
Human Description:
potassium voltage-gated channel, subfamily G, member 4 [Source:HGNC Symbol;Acc:19697]
Mouse Orthologue:
Kcng4
Mouse Description:
potassium voltage-gated channel, subfamily G, member 4 Gene [Source:MGI Symbol;Acc:MGI:1913983]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41045 Nonsense Mutation detected in F1 DNA During 2016
sa11914 Nonsense Available for shipment Available now
sa12320 Nonsense Available for shipment Available now
sa17124 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073600 Nonsense 25 535 1 2
Genomic Location (Zv9):
Chromosome 7 (position 57915095)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56350421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGACTTTAGCAATCTCTCGGTCAGCACAGATGACAGCAGTCTTGACT[T/A]GTTCTTCACTGAAATCCCAGAGACTGAAACCATCAAAGGCGTGTACTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073600 Nonsense 269 535 2 2
ENSDART00000073600 Nonsense 269 535 2 2
Genomic Location (Zv9):
Chromosome 7 (position 57918235)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56353561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAAAAGTGCCGCAACATATTCATTGTGGAAACGGTGTGTGTRGCCTG[G/A]TTCTCYATGGAGTTTTTGTTGCGCTTCCTGCAGGCTGAAAGCAAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073600 Nonsense 269 535 2 2
ENSDART00000073600 Nonsense 269 535 2 2
Genomic Location (Zv9):
Chromosome 7 (position 57918235)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56353561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAAAAGTGCCGCAACATATTCATTGTGGAAACGGTGTGTGTRGCCTG[G/A]TTCTCYATGGAGTTTTTGTTGCGCTTCCTGCAGGCTGAAAGCAAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073600 Nonsense 347 535 2 2
Genomic Location (Zv9):
Chromosome 7 (position 57918469)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56353795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAAACTGGGTTTAATACTGCGGGTCATGCGGGCCCTGCGAATCCTCTA[T/A]GTAATGCGRCTGGCRAGACACTCATTGGGCCTTCAGACGCTTGGTCTTAY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link