dhodh

Ensembl ID:
ENSDARG00000051889
ZFIN ID:
ZDB-GENE-030131-3157
Description:
dihydroorotate dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001008608]
Human Orthologue:
DHODH
Human Description:
dihydroorotate dehydrogenase [Source:HGNC Symbol;Acc:2867]
Mouse Orthologue:
Dhodh
Mouse Description:
dihydroorotate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1928378]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41042 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073597 Nonsense 174 407 5 9
Genomic Location (Zv9):
Chromosome 7 (position 57788899)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56224225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAGTCATCCTAGACTGTATCTACACTCATGTTCAATATCAGCAGGC[A/T]AACCTCTTGGCATCAATCTTGGAAAGAACAAGCTTTCGCCAGATGCAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link