ANKRD11

Ensembl ID:
ENSDARG00000051886
Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Human Orthologue:
ANKRD11
Human Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Mouse Orthologue:
Ankrd11
Mouse Description:
ankyrin repeat domain 11 Gene [Source:MGI Symbol;Acc:MGI:1924337]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16144 Essential Splice Site Available for shipment Available now
sa17722 Nonsense Available for shipment Available now
sa31604 Nonsense Available for shipment Available now
sa31605 Nonsense Available for shipment Available now
sa41040 Nonsense Mutation detected in F1 DNA During 2016
sa31606 Nonsense Available for shipment Available now
sa7090 Nonsense Mutation detected in F1 DNA During 2016
sa11367 Nonsense Available for shipment Available now
sa21093 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 248 2820 5 11
Genomic Location (Zv9):
Chromosome 7 (position 57657759)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56093085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGACGACACGCCTCTACATGATGCATCTAACAATGGCCATCTCAAAG[T/C]AAGTGACTCAGAAATKATACWTTACAKTTTTTTACACAAGATAGCAMACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 289 2820 6 11
Genomic Location (Zv9):
Chromosome 7 (position 57657986)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56093312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCAAATTCACAAACAATGCTTAATTTGTTGTTGGGGAAAATCACCTA[C/A]TCCTCCAGTGAGGAGAGTTCCTCWGGTATGTATCATGAAGTGCATCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 599 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57659002)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56094328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGAGTCAGACTACTCATCTGCAGACTCCAGTGTTGAGTCTGTGAAA[C/T]AGGTAAAAAAGAAAGTGCAAGACAGCAGAAAGAAAAACAACACGCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1548 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57661851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56097177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAAAACACTCAAATATCAAGTATTAAAGAGAAATCAAAAGAAGACTG[T/A]TCTAAATTTGACGGCAAAAATAAGGACAGGATTAAAGATATAGTGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1768 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57662509)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56097835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCATCCTGCAGTGCAGAGGACTATTCAGATATCATGTTTGATGGTCTT[G/T]AGTGTCATAATTCCTCAGCCACCACAATGTCCATGAATGCTTGTTCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2170 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57663715)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56099041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACTGGAGTCCGAATCACCTCAGCTAGAAAATTTCTTCACTGATTGT[A/T]AACCAACCCCTGAGGAAAATCAGATGGACCTAGAGTTGCCATGCATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2570 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57664915)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100241
KASP Assay ID:
554-4997.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTCAGTTGGTGAACACAGCAATGAAGCAGACTCGGGAGATGATCCAA[C/T]AAACTCTAGCAGTCATTGTGAAYGCCATCAAATTGGATGAAATCGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2664 2820 8 11
Genomic Location (Zv9):
Chromosome 7 (position 57665372)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTGCTCCACCACCATCTTTGTCAGARCCCCTGAAGGAGTTGTTCAGA[C/T]AGCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 2680 2820 8 11
Genomic Location (Zv9):
Chromosome 7 (position 57665424)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGGG[T/A]AAACTTTTACTCTTTGCCTTTAGACTTTTTTTGTTTTCTCCCCTCTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link