ANKRD11

Ensembl ID:
ENSDARG00000051886
Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Human Orthologue:
ANKRD11
Human Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Mouse Orthologue:
Ankrd11
Mouse Description:
ankyrin repeat domain 11 Gene [Source:MGI Symbol;Acc:MGI:1924337]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16144 Essential Splice Site Available for shipment Available now
sa17722 Nonsense Available for shipment Available now
sa8287 Nonsense Mutation detected in F1 DNA During 2014
sa7090 Nonsense Mutation detected in F1 DNA During 2014
sa11367 Nonsense Available for shipment Available now
sa21093 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 248 2820 5 11
Genomic Location:
Chromosome 7 (position 57657759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGACGACACGCCTCTACATGATGCATCTAACAATGGCCATCTCAAAG[T/C]AAGTGACTCAGAAATKATACWTTACAKTTTTTTACACAAGATAGCAMACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 289 2820 6 11
Genomic Location:
Chromosome 7 (position 57657986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCAAATTCACAAACAATGCTTAATTTGTTGTTGGGGAAAATCACCTA[C/A]TCCTCCAGTGAGGAGAGTTCCTCWGGTATGTATCATGAAGTGCATCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1911 2820 7 11
Genomic Location:
Chromosome 7 (position 57662940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTGTAAATTCCATCAGTGATGGWAATGAATACTCAGGGTGTGTGTA[T/G]AACARCTATCTMATGAAGCCCTCAACTCCAGTCCATAGACYTGACCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2570 2820 7 11
Genomic Location:
Chromosome 7 (position 57664915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTCAGTTGGTGAACACAGCAATGAAGCAGACTCGGGAGATGATCCAA[C/T]AAACTCTAGCAGTCATTGTGAAYGCCATCAAATTGGATGAAATCGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2664 2820 8 11
Genomic Location:
Chromosome 7 (position 57665372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTGCTCCACCACCATCTTTGTCAGARCCCCTGAAGGAGTTGTTCAGA[C/T]AGCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 2680 2820 8 11
Genomic Location:
Chromosome 7 (position 57665424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGGG[T/A]AAACTTTTACTCTTTGCCTTTAGACTTTTTTTGTTTTCTCCCCTCTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fna5pud9