abcc8

Ensembl ID:
ENSDARG00000051879
ZFIN IDs:
ZDB-GENE-050517-22, ZDB-GENE-050517-22
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:RefSeq peptide;Acc:NP_001166118]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15863 Nonsense Available for shipment Available now
sa13411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 None None 482 9 34
ENSDART00000088422 Nonsense 499 1594 10 40
Genomic Location:
Chromosome 25 (position 23485467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGCTCCRGTGCAGTACTTTGTGGCAACCAAGTTATCAGATGCACAG[A/T]AAAGCACATTGGTGAGCTACTTTATTTTGGTTAATGTCCTAATGAGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Nonsense 132 482 26 34
ENSDART00000088422 None None 1594 None 40
Genomic Location:
Chromosome 25 (position 23550261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYTATTTGGATCCTCTGCACTTTGTCGCTTCTGCACTTGATCTGCAATA[T/A]AAGATTATTACTTGTCTTGGATGCGGAAATAAAGCAGCGTGCACGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2l147to2