abcc8

Ensembl ID:
ENSDARG00000051879
ZFIN IDs:
ZDB-GENE-050517-22, ZDB-GENE-050517-22
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:RefSeq peptide;Acc:NP_001166118]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15863 Nonsense Available for shipment Available now
sa44308 Nonsense Mutation detected in F1 DNA During 2016
sa38076 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586   None 482 9 34
ENSDART00000088422 Nonsense 499 1594 10 40
Genomic Location (Zv9):
Chromosome 25 (position 23485467)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22664580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGCTCCRGTGCAGTACTTTGTGGCAACCAAGTTATCAGATGCACAG[A/T]AAAGCACATTGGTGAGCTACTTTATTTTGGTTAATGTCCTAATGAGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586   None 482 21 34
ENSDART00000088422 Nonsense 856 1594 22 40
Genomic Location (Zv9):
Chromosome 25 (position 23531209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22710322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTCTGGAGGCCAGAGACAACGGATTAGTGTGGCTCGAGCTCTTTA[T/A]CAAACTACCAATGTGGTGTTCCTGGTAGGTTAAGATACATCTGTACTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Essential Splice Site None 482 23 34
ENSDART00000088422 Essential Splice Site 952 1594 24 40
Genomic Location (Zv9):
Chromosome 25 (position 23536984)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22716097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGCAGTGGAAGACTCTGATGCACAGACAAGACAAGGAATTTGAGAAG[G/A]TAGACTGCTGAAAATAAATGAGATATGAGAGAAAGCGTTTTGAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Nonsense 132 482 26 34
ENSDART00000088422   None 1594 None 40
Genomic Location (Zv9):
Chromosome 25 (position 23550261)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22729374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYTATTTGGATCCTCTGCACTTTGTCGCTTCTGCACTTGATCTGCAATA[T/A]AAGATTATTACTTGTCTTGGATGCGGAAATAAAGCAGCGTGCACGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link