ush1c

Ensembl ID:
ENSDARG00000051876
ZFIN ID:
ZDB-GENE-060312-41
Description:
harmonin [Source:RefSeq peptide;Acc:NP_001035018]
Human Orthologue:
USH1C
Human Description:
Usher syndrome 1C (autosomal recessive, severe) [Source:HGNC Symbol;Acc:12597]
Mouse Orthologue:
Ush1c
Mouse Description:
Usher syndrome 1C homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1919338]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8684 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9749 Essential Splice Site Available for shipment Available now
sa24680 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073584 None None 548 None 21
ENSDART00000121791 None None 548 None 21
ENSDART00000129484 Essential Splice Site 422 895 16 29
ENSDART00000131991 Essential Splice Site 430 674 15 18
ENSDART00000131993 None None 134 None 6
Genomic Location:
Chromosome 25 (position 23405262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCGGTTGGTTCTACCGTTATGAAGGAAAGTTGCCTACACTCAAAAAGG[T/C]ACTGCAAGCATGGTGTGCTGGTTTGGTGTGCTATAACAATAGAGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073584 None None 548 None 21
ENSDART00000121791 None None 548 None 21
ENSDART00000129484 Essential Splice Site 510 895 19 29
ENSDART00000131991 Essential Splice Site 524 674 17 18
ENSDART00000131993 None None 134 None 6
Genomic Location:
Chromosome 25 (position 23406443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAACAAGACTAGAGCAAATCTCCTCGGTRGAAAACGAGTCTCCAGAG[G/A]TAAAGTCTACCACTCAACATCCCAATGTGTTGGTCTTGTTACTCACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073584 None None 548 None 21
ENSDART00000121791 None None 548 None 21
ENSDART00000129484 Missense 726 895 23 29
ENSDART00000131991 None None 674 None 18
ENSDART00000131993 Essential Splice Site 13 134 None 6
Genomic Location:
Chromosome 25 (position 23411277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTTTCAGCCCCCGGAGATGCTAAAGCGGATGGTCACATACAACACG[T/A]CCTTTAAATCCAGCAAGAAACAAGTAACTGTCATCATTGCTTTTCATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2s0qyote