islr2

Ensembl ID:
ENSDARG00000051875
ZFIN ID:
ZDB-GENE-050320-95
Description:
immunoglobulin superfamily containing leucine-rich repeat protein 2 [Source:RefSeq peptide;Acc:NP_0
Human Orthologues:
ISLR, ISLR2
Human Descriptions:
immunoglobulin superfamily containing leucine-rich repeat 2 [Source:HGNC Symbol;Acc:29286]
immunoglobulin superfamily containing leucine-rich repeat [Source:HGNC Symbol;Acc:6133]
Mouse Orthologues:
Islr, Islr2
Mouse Descriptions:
immunoglobulin superfamily containing leucine-rich repeat 2 Gene [Source:MGI Symbol;Acc:MGI:2444277]
immunoglobulin superfamily containing leucine-rich repeat Gene [Source:MGI Symbol;Acc:MGI:1349645]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa82 Nonsense Available for shipment Available now
sa24679 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa82
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073583 Nonsense 208 712 2 2
Genomic Location:
Chromosome 25 (position 23361043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTGGCTTAGGGACTGGATCCTCAAATCCTCAATCTCCATTCCTGAA[C/T]AAAACAACATCGCTTGCGATGCCCCATCCCACCTCAAAGGTTCTCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073583 Nonsense 309 712 2 2
Genomic Location:
Chromosome 25 (position 23360740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACATTCCGATTAATGGCCCACCTACAAACACCAGGTTCCTCGTGTTT[C/T]AAAATGGCACCCTGATCGTTCCTCGCATGAGCAAGAAAGAAGAGGGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/knz56jol