islr2

Ensembl ID:
ENSDARG00000051875
ZFIN ID:
ZDB-GENE-050320-95
Description:
immunoglobulin superfamily containing leucine-rich repeat protein 2 [Source:RefSeq peptide;Acc:NP_0
Human Orthologues:
ISLR, ISLR2
Human Descriptions:
immunoglobulin superfamily containing leucine-rich repeat 2 [Source:HGNC Symbol;Acc:29286]
immunoglobulin superfamily containing leucine-rich repeat [Source:HGNC Symbol;Acc:6133]
Mouse Orthologues:
Islr, Islr2
Mouse Descriptions:
immunoglobulin superfamily containing leucine-rich repeat 2 Gene [Source:MGI Symbol;Acc:MGI:2444277]
immunoglobulin superfamily containing leucine-rich repeat Gene [Source:MGI Symbol;Acc:MGI:1349645]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44307 Nonsense Mutation detected in F1 DNA During 2016
sa82 Nonsense Available for shipment Available now
sa24679 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073583 Nonsense 51 712 2 2
Genomic Location:
Chromosome 25 (position 23361513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTTCGTAGACTGTGCCTACAAAGACCTTGTGGAAGTACCTGTGGGTT[T/A]GCCGTCCAATGCAAGCACCCTGAGTCTTTCAGCGAACAAGATTAAAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa82
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073583 Nonsense 208 712 2 2
Genomic Location:
Chromosome 25 (position 23361043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTGGCTTAGGGACTGGATCCTCAAATCCTCAATCTCCATTCCTGAA[C/T]AAAACAACATCGCTTGCGATGCCCCATCCCACCTCAAAGGTTCTCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073583 Nonsense 309 712 2 2
Genomic Location:
Chromosome 25 (position 23360740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACATTCCGATTAATGGCCCACCTACAAACACCAGGTTCCTCGTGTTT[C/T]AAAATGGCACCCTGATCGTTCCTCGCATGAGCAAGAAAGAAGAGGGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link