pkp3

Ensembl ID:
ENSDARG00000051861
ZFIN ID:
ZDB-GENE-060512-114
Description:
plakophilin 3 [Source:RefSeq peptide;Acc:NP_001038745]
Human Orthologue:
PKP3
Human Description:
plakophilin 3 [Source:HGNC Symbol;Acc:9025]
Mouse Orthologue:
Pkp3
Mouse Description:
plakophilin 3 Gene [Source:MGI Symbol;Acc:MGI:1891830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5999 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067478 Nonsense 509 710 6 9
ENSDART00000123211 Nonsense 509 869 6 13
ENSDART00000139110   None 93 None 3
Genomic Location (Zv9):
Chromosome 25 (position 22887679)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22066792
KASP Assay ID:
554-3941.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATTCCCWGTAGGTATCCTCTGGAATTTGTCCTCTAAGGATARTCTG[A/T]AAGAAAGGCTGGCACGAGAAATTCTTCCTGAATTGACAGACAGGATTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link