ccdc33

Ensembl ID:
ENSDARG00000051858
ZFIN ID:
ZDB-GENE-101011-1
Description:
LOC553442 protein [Source:UniProtKB/TrEMBL;Acc:Q1RM79]
Human Orthologue:
CCDC33
Human Description:
coiled-coil domain containing 33 [Source:HGNC Symbol;Acc:26552]
Mouse Orthologue:
Ccdc33
Mouse Description:
coiled-coil domain containing 33 Gene [Source:MGI Symbol;Acc:MGI:1922464]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10042 Nonsense Available for shipment Available now
sa32533 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073573 Nonsense 323 411 9 11
ENSDART00000124683   None 265 None 8
Genomic Location (Zv9):
Chromosome 25 (position 23063215)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22242328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGAACAACACTTAGTTTCATTATTGGTTTTWATCTCAGTCCTTATA[T/G]CAGCCTTTCTCAGACAGTGAGAAACTGGAATTACTGACACAACTGGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073573 Nonsense 337 411 9 11
ENSDART00000124683   None 265 None 8
Genomic Location (Zv9):
Chromosome 25 (position 23063175)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22242288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCTTATATCAGCCTTTCTCAGACAGTGAGAAACTGGAATTACTGACA[C/T]AACTGGCGAGAGCTGAGGGTCAAATCCAGACACTGGAGCAGCAGGTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link