cdt1

Ensembl ID:
ENSDARG00000051854
ZFIN ID:
ZDB-GENE-070111-1
Human Orthologue:
CDT1
Human Description:
chromatin licensing and DNA replication factor 1 [Source:HGNC Symbol;Acc:24576]
Mouse Orthologue:
Cdt1
Mouse Description:
chromatin licensing and DNA replication factor 1 Gene [Source:MGI Symbol;Acc:MGI:1914427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34200 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098476 Nonsense 241 678 3 10
Genomic Location (Zv9):
Chromosome 7 (position 56785443)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55220769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGAGGATGTGGCGGCGTTGAAGTCCAAGCTGCAGAAACTAAAGGGA[C/T]AGTCTGAAAATGTGTCGACTCCCTCACCTGGCCCAGTGTCCACGCTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link