galns

Ensembl ID:
ENSDARG00000051853
ZFIN IDs:
ZDB-GENE-070112-1152, ZDB-GENE-070112-1152
Description:
N-acetylgalactosamine-6-sulfatase [Source:RefSeq peptide;Acc:NP_001074110]
Human Orthologue:
GALNS
Human Description:
galactosamine (N-acetyl)-6-sulfate sulfatase [Source:HGNC Symbol;Acc:4122]
Mouse Orthologue:
Galns
Mouse Description:
galactosamine (N-acetyl)-6-sulfate sulfatase Gene [Source:MGI Symbol;Acc:MGI:1355303]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31602 Essential Splice Site Available for shipment Available now
sa21091 Nonsense Available for shipment Available now
sa41037 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31601 Essential Splice Site Available for shipment Available now
sa41036 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073556 Essential Splice Site 154 488 5 14
ENSDART00000098468 Essential Splice Site 31 365 6 15
Genomic Location (Zv9):
Chromosome 7 (position 56882266)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55317592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCCGTCCCAATATACCTGTCTACAACAACTCTGAAATGAAGGGAAG[G/A]TGAGGTACAAACATAAAGCGTTTTGGGTTCTTGCCGATAACACCTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073556 Nonsense 155 488 6 14
ENSDART00000098468 Nonsense 32 365 7 15
Genomic Location (Zv9):
Chromosome 7 (position 56879664)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55314990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCATTAGATCTGCGGAAAGCTGAGATGGTCTGTGTGTTTTGCAGGTA[T/G]TACGAGGAGTTTGAGATTAATGTGAAAACGGGTGAATCCAACCTCACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073556 Essential Splice Site 219 488 7 14
ENSDART00000098468 Essential Splice Site 96 365 8 15
Genomic Location (Zv9):
Chromosome 7 (position 56879362)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55314688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCTGTCTACGCCTCAAAACCCTTCTTGGGAAAGAGTCAGAGGGGACG[G/A]TAGGCCAGAATTACAGTATTAAAAAGTATAAAACTGCACAGTGTAACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073556 Essential Splice Site 265 488 8 14
ENSDART00000098468 Essential Splice Site 142 365 9 15
Genomic Location (Zv9):
Chromosome 7 (position 56873343)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55308669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCACCTCGGATAATGGAGCAGCACTGATGTCTGGACCACTGCAAA[G/A]TAGGAGATCTGTTCACACTTTTCCAACTCAAACATTAACACATCTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073556 Nonsense 412 488 12 14
ENSDART00000098468 Nonsense 289 365 13 15
Genomic Location (Zv9):
Chromosome 7 (position 56839067)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55274393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACTCAACAGGAGCACACCATGCAGCCACTCATCTTCCACCTGGGA[C/T]GAGACCCTGGAGAGAGATACCCACTCAGGTAAGTGCTGAAGAGTGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link