kcnc1a

Ensembl ID:
ENSDARG00000051852
ZFIN ID:
ZDB-GENE-061220-10
Description:
potassium voltage-gated channel subfamily C member 1 [Source:RefSeq peptide;Acc:NP_001122197]
Human Orthologue:
KCNC1
Human Description:
potassium voltage-gated channel, Shaw-related subfamily, member 1 [Source:HGNC Symbol;Acc:6233]
Mouse Orthologue:
Kcnc1
Mouse Description:
potassium voltage gated channel, Shaw-related subfamily, member 1 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099934 Nonsense 184 605 1 4
Genomic Location (Zv9):
Chromosome 7 (position 34363680)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32758020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGCAACGCTGGCAGCGTCGTGTTTGGGCGCTCTTTGAAGATCCCTA[T/A]TCCTCCAAATATGCAAGGGTGAGTGATGAACACGTTTTGCAGTGGCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link