si:busm1-70b1.2

Ensembl ID:
ENSDARG00000051827
ZFIN ID:
ZDB-GENE-040724-9
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q6ZM43]
Human Orthologue:
GRAMD2
Human Description:
GRAM domain containing 2 [Source:HGNC Symbol;Acc:27287]
Mouse Orthologue:
Gramd2
Mouse Description:
GRAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:3528937]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34194 Nonsense Mutation detected in F1 DNA During 2017
sa21088 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073518 Nonsense 95 354 4 12
Genomic Location (Zv9):
Chromosome 7 (position 55735398)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53319112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCTGATTTCCCTTTCCTCTACCCCCTCACAGACCGTCAGCAAGTA[C/A]AATGCGCAGTACCACAAGCTCTTCCAGAGCGTGCCCAAAGAAGAGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073518 Essential Splice Site 115 354 5 12
Genomic Location (Zv9):
Chromosome 7 (position 55728831)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53325679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTATCATCTTGCATCTCTTGCATAAGTGACCTTGTGACCTGTTCTTTA[G/A]TGTACTCATGCGCCCTGCTCAGAGATATCCTCCTGCAAGGCCGACTCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link