tmeff2a

Ensembl ID:
ENSDARG00000051824
ZFIN ID:
ZDB-GENE-070912-622
Description:
transmembrane protein with EGF-like and two follistatin-like domains 2a [Source:RefSeq peptide;Acc:
Human Orthologue:
TMEFF2
Human Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 [Source:HGNC Symbol;Acc:11867
Mouse Orthologue:
Tmeff2
Mouse Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8338 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34644 Nonsense Mutation detected in F1 DNA During 2016
sa14883 Essential Splice Site Available for shipment Available now
sa31714 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41421 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 Essential Splice Site 61 370 1 9
ENSDART00000135897 Essential Splice Site 61 379 1 10
Genomic Location:
Chromosome 9 (position 25445705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGTCCTCTCTCAGCGACTGTCAGACTCCAACTGGATGGAACTGCTCGG[G/A]TAAGATGTTCAAGTAGCGCTGAAAGKAAAACGGTTTGACGTTTCCTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 Nonsense 136 370 3 9
ENSDART00000135897 Nonsense 136 379 3 10
Genomic Location:
Chromosome 9 (position 25399439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCGGAGAGACGCCTGCAAACAGCAGACTGAGATCCTGGTTGTGTCT[G/T]AAGGATCCTGTCCAGCCGGTATGTGCATTCGTGTATCCCATGAGTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512   244 370 6 9
ENSDART00000135897 Essential Splice Site 253 379 7 10
Genomic Location:
Chromosome 9 (position 25289000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGCACCAAAGCMGGAGATGGAYAGTATGCCAGGAYAGACTACACAG[G/A]TGGGTTTCATCATTATTATTATATTRTTGGTCACACTTTAYAATAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 Essential Splice Site 286 370 7 9
ENSDART00000135897 Essential Splice Site 295 379 8 10
Genomic Location:
Chromosome 9 (position 25288375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCATGGAGACTGTGAATATCCCAACATGCTCTCAACACCGTCCTGCAG[G/A]TACACACCACTCACACACATTTCTTTGTTTGTGAATGGTGTGAATGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 Nonsense 315 370 8 9
ENSDART00000135897 Nonsense 324 379 9 10
Genomic Location:
Chromosome 9 (position 25285814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGTATAATGTGCTATATGTGGTGCCAGGCTCTGGAAAGCTCCGCTA[T/A]GTCCTCATCGCGTCCGTCATTGGTGCTCTGCAGGTGGCCATCATATGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link