tmeff2a

Ensembl ID:
ENSDARG00000051824
ZFIN ID:
ZDB-GENE-070912-622
Description:
transmembrane protein with EGF-like and two follistatin-like domains 2a [Source:RefSeq peptide;Acc:
Human Orthologue:
TMEFF2
Human Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 [Source:HGNC Symbol;Acc:11867
Mouse Orthologue:
Tmeff2
Mouse Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8338 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14883 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 Essential Splice Site 61 370 1 9
ENSDART00000135897 Essential Splice Site 61 379 1 10
Genomic Location:
Chromosome 9 (position 25445705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGTCCTCTCTCAGCGACTGTCAGACTCCAACTGGATGGAACTGCTCGG[G/A]TAAGATGTTCAAGTAGCGCTGAAAGKAAAACGGTTTGACGTTTCCTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073512 None 244 370 6 9
ENSDART00000135897 Essential Splice Site 253 379 7 10
Genomic Location:
Chromosome 9 (position 25289000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGCACCAAAGCMGGAGATGGAYAGTATGCCAGGAYAGACTACACAG[G/A]TGGGTTTCATCATTATTATTATATTRTTGGTCACACTTTAYAATAAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwd0k8tv