aass

Ensembl ID:
ENSDARG00000051816
ZFIN ID:
ZDB-GENE-061220-8
Description:
aminoadipate-semialdehyde synthase [Source:RefSeq peptide;Acc:NP_001167456]
Human Orthologue:
AASS
Human Description:
aminoadipate-semialdehyde synthase [Source:HGNC Symbol;Acc:17366]
Mouse Orthologue:
Aass
Mouse Description:
aminoadipate-semialdehyde synthase Gene [Source:MGI Symbol;Acc:MGI:1353573]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12304 Nonsense Available for shipment Available now
sa25230 Nonsense Mutation detected in F1 DNA During 2014
sa24697 Essential Splice Site Available for shipment Available now
sa11599 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073502 Nonsense 38 935 1 23
Genomic Location:
Chromosome 25 (position 29149100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCAGCATAACCAGCAGAATCACAAAASTGTGATCGCCATCCGGCGT[G/T]AGRATGTCAACGTGTGGGAGAGACGTGCGCCCCTCGCCCCACGACACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073502 Nonsense 210 935 5 23
Genomic Location:
Chromosome 25 (position 29153557)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTACAGAAATGTCAGCCAGGCCATCCAGGCAGTAAGGGATTGTGGATA[T/A]GAAATATCTTTAGGTCTGATGCCCAAGTCCATAGGCCCTCTTACATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073502 Essential Splice Site 454 935 11 23
Genomic Location:
Chromosome 25 (position 29160722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCACCAAACCACTGGAGGAAGAGGATTTCTCTCCACAAGTCAGAGAT[G/T]TAAGACTGTGATTATTTTTCTTTGTTAAAGAAACACTACACTTTTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073502 Essential Splice Site 518 935 14 23
Genomic Location:
Chromosome 25 (position 29175394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGCAGTYGCTGTCCTTTCGCAAATCTTATGTGATCTTTTCATTGCA[G/T]CATCAAATCTGTTGAATCAGGCWGAAGAGATGGCAACCAGATACCCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2y4hrcs7