D2U819_DANRE

Ensembl ID:
ENSDARG00000051814
Description:
Protein tyrosine phosphatase zeta A [Source:UniProtKB/TrEMBL;Acc:D2U819]
Human Orthologue:
PTPRZ1
Human Description:
protein tyrosine phosphatase, receptor-type, Z polypeptide 1 [Source:HGNC Symbol;Acc:9685]
Mouse Orthologue:
Ptprz1
Mouse Description:
protein tyrosine phosphatase, receptor type Z, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:97816]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24698 Nonsense Available for shipment Available now
sa31112 Nonsense Mutation detected in F1 DNA During 2017
sa44326 Nonsense Mutation detected in F1 DNA During 2017
sa17534 Nonsense Available for shipment Available now
sa5709 Nonsense F2 line generated During 2017
sa3303 Nonsense F2 line generated During 2017
sa18334 Nonsense Available for shipment Available now
sa14712 Nonsense Available for shipment Available now
sa44325 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 223 2077 5 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29281651)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27971745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGTAGAGTGGATCGTCTTCAAAAACACAGTGGCCATCTCAGATGTT[C/T]AGGTCAGCTTTATTGACAGTTGTTGTTTCCCCCTGTTAGCTCATCAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29254469)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27944563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTGATGACACATGGTACTTGAGGTTACATACAGTAGTTATAAA[C/T]AAAGCTCACACGCTTGCGTATAGTGTGTTCAGGCTGAAATCCAGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29254469)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27944563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTGATGACACATGGTACTTGAGGTTACATACAGTAGTTATAAA[C/T]AAAGCTCACACGCTTGCGTATAGTGTGTTCAGGCTGAAATCCAGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 437 2077 12 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29253804)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27943898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAAAATCATACATYTTCTACCTTTTAATRTTTCCATGCTTCACAAAT[C/T]GATATTGTCAACATATCACAAARTCTCTGGGGTCTTTTCCANCCATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5709
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940815
KASP Assay ID:
554-2906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGTYGATTCTTCTCTAGCAGCTCCTACTTTCAGTAGTAAATTCTCYT[T/A]GCATGCCTCTTCCAACTCCCTGCTGCCTTCCTCGGTTTCTGRACTGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3303
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940815
KASP Assay ID:
554-2906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGTYGATTCTTCTCTAGCAGCTCCTACTTTCAGTAGTAAATTCTCTT[T/A]GCATGCCTCTTCCAACTCCCTGCTGCCTTCCTCGGTTTCTGRACTGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCAGATGGGCAGCAGGAGAACAGTGCCTCAGGCTGGACTTTCGATT[T/A]AGACTGGGGCCAAAGCTCAGCATCAGGAGACGAGAGTATYGCCGCTSCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540   None 104 None 5
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCAGATGGGCAGCAGGAGAACAGTGCCTCAGGCTGGACTTTCGATT[T/A]AGACTGGGGCCAAAGCTCAGCATCAGGAGACGAGAGTATYGCCGCTSCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Essential Splice Site 1276 2077 20 41
ENSDART00000127540   None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29249093)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27939187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCCTAGGCCATGTCTTAATCTCTCAAACGTGTCTGTCTGCAATGAA[T/A]CATGACCTATGAACTTCTTAGCTTCTTTGTGTGAAACACATTTCTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1823 2077 36 41
ENSDART00000127540   5 104 1 5
Genomic Location (Zv9):
Chromosome 25 (position 29224317)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27914411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTAGTTCCACAAAAGTGACTGYGGTGTGTTTTGCAGTGGAGAAGTCT[C/T]GAGTGTGTGYGTCCTCGTCAGCAGGAGAAACRTCAGATTACRTCAACGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link