ugt5a5

Ensembl ID:
ENSDARG00000051805
ZFIN ID:
ZDB-GENE-100406-2
Description:
UDP glucuronosyltransferase 5 family, polypeptide A5 [Source:RefSeq peptide;Acc:NP_001170968]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19368 Nonsense Mutation detected in F1 DNA During 2014
sa12601 Nonsense Available for shipment Available now
sa6807 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073488 Nonsense 16 529 2 2
Genomic Location:
Chromosome 25 (position 30364747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAAAAAAAAAAAGATGCCTTCCCTCCCTGCAACATTGTTAGCATTCT[T/A]GAGCATATTATCTCTAGTGTTTGGAGGTAAAGTGTTGGTGTTTCCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073488 Nonsense 277 529 2 2
Genomic Location:
Chromosome 25 (position 30363963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGATTTCACRTTTGAGTTTCCWCGACCCACAATGCCAAATATTGTCTA[T/A]ATGGGAGGCTTCCAGTGCARACCATCCAAGCCKCTTCCAGATGATCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073488 Nonsense 400 529 2 2
Genomic Location:
Chromosome 25 (position 30363596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCATTTATCACGGAGTTCCCATTTTGGGTCTMCCTTTAGTGTTCGAT[C/T]AACCTGACAACTTGTCTAGAATGAAAGTTAGAGGCACAGCAAAACTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rd2n3tlw