A2RV11_DANRE

Ensembl ID:
ENSDARG00000051800
Description:
FNBP4 protein [Source:UniProtKB/TrEMBL;Acc:A2RV11]
Human Orthologue:
FNBP4
Human Description:
formin binding protein 4 [Source:HGNC Symbol;Acc:19752]
Mouse Orthologue:
Fnbp4
Mouse Description:
formin binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1860513]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12611 Nonsense Available for shipment Available now
sa24699 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126490 Nonsense 526 853 11 17
Genomic Location:
Chromosome 25 (position 29520168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACATAAAACATTACGAACTTAACGCCMCTCCCAAAGGCTGGYCCTG[C/A]CACTGGGACAGGTACGSGCTCCTTACCTTTCACATCCYTATCCCCCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126490 Nonsense 819 853 16 17
Genomic Location:
Chromosome 25 (position 29508223)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGATCGAGATCAGCTGAACAACAGACGCATCGAAGAATGGAAACAA[C/T]AACAGCTTTCAACGTAAGTCGAAAGAAGGCTTTGCCAGTATGGGTAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zy6wjvmg