A2RV11_DANRE

Ensembl ID:
ENSDARG00000051800
Description:
FNBP4 protein [Source:UniProtKB/TrEMBL;Acc:A2RV11]
Human Orthologue:
FNBP4
Human Description:
formin binding protein 4 [Source:HGNC Symbol;Acc:19752]
Mouse Orthologue:
Fnbp4
Mouse Description:
formin binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1860513]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38098 Nonsense Available for shipment Available now
sa12611 Nonsense Available for shipment Available now
sa24699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126490 Nonsense 16 853 1 17
Genomic Location (Zv9):
Chromosome 25 (position 29535357)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28225451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGATGGGGAAGAAGACTCGAGCAGGCACCGGCAGGAGAACCATATTA[C/T]AGCTTTCACCGCCAGGACCGAACCGCAGCGCCACAGGAACTGCTCGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126490 Nonsense 526 853 11 17
Genomic Location (Zv9):
Chromosome 25 (position 29520168)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28210262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACATAAAACATTACGAACTTAACGCCMCTCCCAAAGGCTGGYCCTG[C/A]CACTGGGACAGGTACGSGCTCCTTACCTTTCACATCCYTATCCCCCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126490 Nonsense 819 853 16 17
Genomic Location (Zv9):
Chromosome 25 (position 29508223)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28198317
KASP Assay ID:
2261-9832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGATCGAGATCAGCTGAACAACAGACGCATCGAAGAATGGAAACAA[C/T]AACAGCTTTCAACGTAAGTCGAAAGAAGGCTTTGCCAGTATGGGTAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link