LOC562203

Ensembl ID:
ENSDARG00000051795
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44285 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa38060 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa24662 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Splice Site, Nonsense 164 626 3 12
Genomic Location:
Chromosome 25 (position 20174278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTATAACCAGAGTACCAGTCAAAGGCCAACCAGAAGACATCGGAGAC[C/T]AGGTGAACATCAGAAAAATTGCTTTATTAAAAAGCAAATGTCTATGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Splice Site, Nonsense 467 626 10 12
Genomic Location:
Chromosome 25 (position 20179624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGTGCGAGCTATGTTTCCCAAACTACCCGCATCTGAGACACATAATA[C/T]AGGTAGGTTCAAATGACTCTTGTTTATCATTTTGTATCATTTTATAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Nonsense 556 626 12 12
Genomic Location:
Chromosome 25 (position 20183757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATTGCACTGAAAATCTCATGTCCTCTCGGTCAATCAGATTGTGTA[T/G]CAGCGTCTGGCCGACTACATTCCCATGGTGATCCTGTTGTTCATGCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link