NP_001093527.3

Ensembl ID:
ENSDARG00000051785
Description:
putative ATP-dependent RNA helicase DHX33-like [Source:RefSeq peptide;Acc:NP_001093527]
Human Orthologue:
DHX33
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 33 [Source:HGNC Symbol;Acc:16718]
Mouse Orthologue:
Dhx33
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 33 Gene [Source:MGI Symbol;Acc:MGI:2445102]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20330 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013063 Essential Splice Site 123 676 2 12
Genomic Location (Zv9):
Chromosome 5 (position 2078178)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1703525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGCCGGTCGAGTGGCTGAAGAGAAGAAAGTGCAGCTGGGGAAACTGG[T/A]GTGTTTATTACTCATTACACTAGCGCTGAATGATGCTGGAAACACTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link