LOC561098

Ensembl ID:
ENSDARG00000051768
Human Orthologue:
FHOD1
Human Description:
formin homology 2 domain containing 1 [Source:HGNC Symbol;Acc:17905]
Mouse Orthologue:
Fhod1
Mouse Description:
formin homology 2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679008]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10817 Essential Splice Site Available for shipment Available now
sa18876 Nonsense Mutation detected in F1 DNA During 2014
sa12078 Nonsense Available for shipment Available now
sa14180 Nonsense Available for shipment Available now
sa922 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073447 Essential Splice Site 240 1399 7 33
Genomic Location:
Chromosome 7 (position 36038355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAGTCCACTGCTTATTCAGGCCGTCAACRTTGTGGATGGAAAGAGAGG[T/C]GAAACCCACATTWAATCTTCTTTCAAAATACTCTGAATYCATAAAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073447 Nonsense 283 1399 9 33
ENSDART00000073447 Nonsense 283 1399 9 33
Genomic Location:
Chromosome 7 (position 36039384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGTCCTCTCAGACTCTGGCAGCACTTCCTGATCAGGACTCATTTTA[T/G]GATGTGACAGACTGTTTGGAGCAGCTAGAAATGGAAAGCATCATCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073447 Nonsense 283 1399 9 33
ENSDART00000073447 Nonsense 283 1399 9 33
Genomic Location:
Chromosome 7 (position 36039384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NCTCTGTCCTCTYAGACTCTGGCAGCACTTCCTGATCAGGACTCATTTTA[T/G]GATGTGACAGACTGTTTGGAGCAGCTAGAAATGGAAAGCATCATCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073447 Nonsense 868 1399 24 33
Genomic Location:
Chromosome 7 (position 36058549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCTTTACCACGTCCCCGTCACAGGGTTTGGATCCTGCTTTTGTGAAG[A/T]AACGKAAAACAGTAAAGTTGTTCTGGAAGGARCTGAAGCARTCTGAYAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073447 Essential Splice Site 1131 1399 28 33
Genomic Location:
Chromosome 7 (position 36064388)
KASP Assay ID:
554-0828.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YACGACTGACCTTTACTCTGAGATCCCTGCYATCACACGCTCTGCTAAAG[T/G]AGGTGACTCTCTATGTGCAGTGTCTTTGTTCTGTTTGTTTCATACCTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/28za7gq8