pdhx

Ensembl ID:
ENSDARG00000051756
ZFIN IDs:
ZDB-GENE-040426-1539, ZDB-GENE-040426-1539
Description:
pyruvate dehydrogenase complex, component X [Source:RefSeq peptide;Acc:NP_956854]
Human Orthologue:
PDHX
Human Description:
pyruvate dehydrogenase complex, component X [Source:HGNC Symbol;Acc:21350]
Mouse Orthologue:
Pdhx
Mouse Description:
pyruvate dehydrogenase complex, component X Gene [Source:MGI Symbol;Acc:MGI:1351627]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30318 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073435 Essential Splice Site 160 319 5 8
ENSDART00000102855 Essential Splice Site 337 496 8 11
Genomic Location (Zv9):
Chromosome 25 (position 38439547)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36861605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTCCGTCAATGACTTCATCATCAAGGCCGCCGCTGTGTCCCTCAGA[G/T]TAAGTGCACACTGCAGCTGTTTCCTACATAGTGTACTACTCTGATCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link