rpgrip1l

Ensembl ID:
ENSDARG00000051754
ZFIN ID:
ZDB-GENE-081104-81
Description:
LOC557688 protein [Source:UniProtKB/TrEMBL;Acc:A1L275]
Human Orthologue:
RPGRIP1L
Human Description:
RPGRIP1-like [Source:HGNC Symbol;Acc:29168]
Mouse Orthologue:
Rpgrip1l
Mouse Description:
Rpgrip1-like Gene [Source:MGI Symbol;Acc:MGI:1920563]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6815 Nonsense Mutation detected in F1 DNA During 2014
sa24730 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3302 Nonsense F2 line generated During 2014
sa10096 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046224 Nonsense 35 931 3 18
ENSDART00000126326 Nonsense 12 1233 1 24
ENSDART00000128303 Nonsense 41 1269 2 27
Genomic Location:
Chromosome 25 (position 37136737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTSCTGTTTTCAGACTCCCTGCTGTCTCAGAACATCAGAGAGAGG[C/T]AGAACGTGTCCAAGTTGAGYCGGGAGGAGCTGGAGGACAAATACCTGCGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046224 Essential Splice Site 337 931 9 18
ENSDART00000126326 Essential Splice Site 314 1233 7 24
ENSDART00000128303 Essential Splice Site 337 1269 9 27
Genomic Location:
Chromosome 25 (position 37145267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGGATAACGATATGATGCTAATAACTATTGTAACTCGAGTCTGTTTCC[A/T]GTTACAAGAGAGAATCCAGGATTTGGAGAAAGAGAGAGACTTGCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3302
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046224 Nonsense 805 931 17 18
ENSDART00000126326 Nonsense 782 1233 15 24
ENSDART00000128303 Nonsense 818 1269 17 27
Genomic Location:
Chromosome 25 (position 37153357)
KASP Assay ID:
554-2852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAAGGTCCTCACACCCAACCCAGTCCCTACATCGTTTACAAACTCTA[T/A]GACTTTCCTGACCACGATACGCCAATAATACCTTGCACCACYGAGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046224 Nonsense 849 931 17 18
ENSDART00000126326 Nonsense 826 1233 15 24
ENSDART00000128303 Nonsense 862 1269 17 27
Genomic Location:
Chromosome 25 (position 37153489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTCCAACCTTGATGCCTTTTTGAGRTCAGAGGCTCTGGTGGTTTA[T/A]GTGTTTGATGATTTAGATGTTGAGAACCAGCTGTATTTGGGGAAGGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Propensity score-based nonparametric test revealing genetic variants underlying bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ymy6w06e