tigara

Ensembl ID:
ENSDARG00000051749
ZFIN ID:
ZDB-GENE-060312-25
Description:
Probable fructose-2,6-bisphosphatase TIGAR A [Source:UniProtKB/Swiss-Prot;Acc:Q29RA5]
Human Orthologue:
C12orf5
Human Description:
chromosome 12 open reading frame 5 [Source:HGNC Symbol;Acc:1185]
Mouse Orthologue:
9630033F20Rik
Mouse Description:
RIKEN cDNA 9630033F20 gene Gene [Source:MGI Symbol;Acc:MGI:2442752]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38041 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38040 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24639 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44263 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 11 256 1 6
Genomic Location (Zv9):
Chromosome 25 (position 17326786)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16873330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGACGCGTCTGCGACATGCTCGCCTTTGGTTTAACAGTAGTCCGACAG[T/C]AAGTTCTGTTTTGTTTGCTTTATGAAAGTGATTTGTTCTATTCATAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 24 256 2 6
Genomic Location (Zv9):
Chromosome 25 (position 17325082)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16871626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTGCCAGTGGTGAGACGCAGTGCAACAAAGATGGCCTTTTACAAGG[T/G]AATTGTTTAGAGAGAAAATTAAAACATATGTTATCTCTACGCATTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 64 256 3 6
Genomic Location (Zv9):
Chromosome 25 (position 17324850)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16871394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATTTACAAATGTGTTTGTCAGCAACATGAAACGTGCCAAGCAGG[T/C]AAACAGAAACACACCAGTAACTAAAACATTCAATCTGTTTACCAGTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Nonsense 142 256 6 6
Genomic Location (Zv9):
Chromosome 25 (position 17321564)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16868108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCAGGTGAAGTTGCGAATTAAGGATTTTCTGAAGGCCATGTACCAG[C/T]GAATAGCAAATGACCATCAAGACAAAGTACAAGATGGAGGAACATCCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link