tigara

Ensembl ID:
ENSDARG00000051749
ZFIN ID:
ZDB-GENE-060312-25
Description:
Probable fructose-2,6-bisphosphatase TIGAR A [Source:UniProtKB/Swiss-Prot;Acc:Q29RA5]
Human Orthologue:
C12orf5
Human Description:
chromosome 12 open reading frame 5 [Source:HGNC Symbol;Acc:1185]
Mouse Orthologue:
9630033F20Rik
Mouse Description:
RIKEN cDNA 9630033F20 gene Gene [Source:MGI Symbol;Acc:MGI:2442752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24639 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 64 256 3 6
Genomic Location:
Chromosome 25 (position 17324850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATTTACAAATGTGTTTGTCAGCAACATGAAACGTGCCAAGCAGG[T/C]AAACAGAAACACACCAGTAACTAAAACATTCAATCTGTTTACCAGTAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ufmydxb