cecr1a

Ensembl ID:
ENSDARG00000051746
ZFIN ID:
ZDB-GENE-030902-4
Description:
Adenosine deaminase CECR1-A [Source:UniProtKB/Swiss-Prot;Acc:P58781]
Human Orthologue:
CECR1
Human Description:
cat eye syndrome chromosome region, candidate 1 [Source:HGNC Symbol;Acc:1839]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38038 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44262 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073416 Essential Splice Site 474 503 9 10
Genomic Location (Zv9):
Chromosome 25 (position 17056941)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16603485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTTTAATTTAGGCACATTGAAAGAGCTAGCTTTAAACTCCCTCAG[G/A]TAGGAAATGACCACAATTTAAACAAAAAAGAGACTGTATATGCAAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073416 Nonsense 500 503 10 10
Genomic Location (Zv9):
Chromosome 25 (position 17057120)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16603664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAAGCTATCGACGCTCTGCTAGTAAAATGGGACAAGTTTGTTTGG[G/T]AAAGTTTACTTTGACAGGACGTTACCACATCAGGACGTTTTTAATTAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link