LOC559395

Ensembl ID:
ENSDARG00000051730
Human Orthologue:
SLC7A10
Human Description:
solute carrier family 7, (neutral amino acid transporter, y+ system) member 10 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a10
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15382 Essential Splice Site Available for shipment Available now
sa17817 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073398 Essential Splice Site 302 517 7 11
Genomic Location:
Chromosome 25 (position 37308342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGTTACTCTTACAAAGCTTTCYTAGCAGCTTTGTTTCGTTTGCTGT[A/T]GACGTTCGGTGAGAAGCTTCTCGGGAWGTTTTCCACACTCATGCCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073398 Nonsense 474 517 10 11
Genomic Location:
Chromosome 25 (position 37306287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGTTTATTTCCTGGGGGTTTACTGGAAAGACAAGCCCAGATGCATATA[T/G]GACTTCACAGGTAAGGGGACTCGATGTGAATGCCGTCTGCTGTTAAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ourmlcik