si:ch73-46g7.3

Ensembl ID:
ENSDARG00000051729
ZFIN ID:
ZDB-GENE-100922-25
Human Orthologue:
NFATC3
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc3
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa974 Nonsense Available for shipment Available now
sa24732 Nonsense Available for shipment Available now
sa44358 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31116 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Nonsense 242 923 2 10
ENSDART00000134928 Nonsense 231 912 1 9
Genomic Location (Zv9):
Chromosome 25 (position 37279135)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35692781
KASP Assay ID:
554-0879.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATCAGCAATCTCTGCAGTATCCGTTTGCCCAGTCTCTATCTCCGTA[T/A]CAATCCCCCCGCACCAGYATCACTGAGGAAACATGGCTCAGTCCGCGTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Nonsense 339 923 2 10
ENSDART00000134928 Nonsense 328 912 1 9
Genomic Location (Zv9):
Chromosome 25 (position 37278846)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35692492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCCTTCCAGTGGACGTGGATGTCCCATCCAAAACCAGAAGAACTTAT[C/T]AGGCAAACCACAACCAGGATCAAGCATCTTTGTTTTCTGGGCAAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
Genomic Location (Zv9):
Chromosome 25 (position 37267620)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35681266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACAATGGGAGGTCAACGTGAGGCCTTTACCGGAGAAGAGTCAAAACG[T/C]GAGCACTGTAAACATTATGCTATGAAACGCTGCAATTCCTCATTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
Genomic Location (Zv9):
Chromosome 25 (position 37267620)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35681266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACAATGGGAGGTCAACGTGAGGCCTTTACCGGAGAAGAGTCAAAACG[T/C]GAGCACTGTAAACATTATGCTATGAAACGCTGCAATTCCTCATTTTCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link