LOC565184

Ensembl ID:
ENSDARG00000046150
Human Orthologue:
B4GALNT4
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 [Source:HGNC Symbol;Acc:26315]
Mouse Orthologue:
B4galnt4
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 Gene [Source:MGI Symbol;Acc:MGI:2652891]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24684 Nonsense Mutation detected in F1 DNA During 2014
sa24685 Nonsense Mutation detected in F1 DNA During 2014
sa13247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083407 Nonsense 370 1172 11 20
Genomic Location:
Chromosome 25 (position 25306853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAACATATGTTGTCAAAGACTTCCCTATTGCCCGCTATCAAGGACTA[C/T]AATTTGTGAGTGTAACGCATGTATTTTACGGCATATTGTTGAATCTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083407 Nonsense 794 1172 14 20
Genomic Location:
Chromosome 25 (position 25317893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGAGGACGTGGAACCTCGGCCTGGATGGGCAGAGGAGGCCATAAATT[G/A]GCAGAGGACATTTTCTGTCAACAGCATGGATTTTGAATCGTTGCGCTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083407 Nonsense 1019 1172 17 20
Genomic Location:
Chromosome 25 (position 25323569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGCGTGTACATGTGTGTGTGTGTTTTTCTGGACACAGATA[T/G]GAGTATCTAAGGAGGGAAGGAAACTTTGAACGTTCTGCCGGCTTACAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mttwa3wb