
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC565184
- Ensembl ID:
- ENSDARG00000046150
- Human Orthologue:
- B4GALNT4
- Human Description:
- beta-1,4-N-acetyl-galactosaminyl transferase 4 [Source:HGNC Symbol;Acc:26315]
- Mouse Orthologue:
- B4galnt4
- Mouse Description:
- beta-1,4-N-acetyl-galactosaminyl transferase 4 Gene [Source:MGI Symbol;Acc:MGI:2652891]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24684 | Nonsense | Available for shipment | Available now |
sa45021 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24685 | Nonsense | Available for shipment | Available now |
sa13247 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24684
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083407 | Nonsense | 370 | 1172 | 11 | 20 |
- Genomic Location (Zv9):
- Chromosome 25 (position 25306853)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 24485966 GRCz11 25 24583514 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCCAACATATGTTGTCAAAGACTTCCCTATTGCCCGCTATCAAGGACTA[C/T]AATTTGTGAGTGTAACGCATGTATTTTACGGCATATTGTTGAATCTAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45021
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083407 | Nonsense | 543 | 1172 | 14 | 20 |
- Genomic Location (Zv9):
- Chromosome 25 (position 25317139)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 24496252 GRCz11 25 24593800 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGAGTGTGGTGAGAGGTCGTTCTCTTGCTTGGGTTCAAAGAGACCGT[A/T]GAGAGGGATGGTCGGAAGAACGTTCCCCCAAAATAAGTAGAACAGCTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24685
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083407 | Nonsense | 794 | 1172 | 14 | 20 |
- Genomic Location (Zv9):
- Chromosome 25 (position 25317893)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 24497006 GRCz11 25 24594554 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTATGAGGACGTGGAACCTCGGCCTGGATGGGCAGAGGAGGCCATAAATT[G/A]GCAGAGGACATTTTCTGTCAACAGCATGGATTTTGAATCGTTGCGCTCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13247
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083407 | Nonsense | 1019 | 1172 | 17 | 20 |
- Genomic Location (Zv9):
- Chromosome 25 (position 25323569)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 24502682 GRCz11 25 24600230 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGTGTGTGTGCGTGTACATGTGTGTGTGTGTTTTTCTGGACACAGATA[T/G]GAGTATCTAAGGAGGGAAGGAAACTTTGAACGTTCTGCCGGCTTACAGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: