prkab1b

Ensembl ID:
ENSDARG00000046143
ZFIN ID:
ZDB-GENE-030131-7172
Description:
protein kinase, AMP-activated, beta 1 non-catalytic subunit, b [Source:RefSeq peptide;Acc:NP_999878
Human Orthologue:
PRKAB1
Human Description:
protein kinase, AMP-activated, beta 1 non-catalytic subunit [Source:HGNC Symbol;Acc:9378]
Mouse Orthologue:
Prkab1
Mouse Description:
protein kinase, AMP-activated, beta 1 non-catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1336167]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16513 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040330 Essential Splice Site 98 260 4 8
ENSDART00000045529 Essential Splice Site 98 173 4 7
ENSDART00000126301 Essential Splice Site 98 260 4 8
Genomic Location (Zv9):
Chromosome 8 (position 41631391)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39644971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTTCTGCTTCCTTTCCCTYATTGTTTTTGTAATGTTCTTCTTTAACA[G/A]TCATAATAATTTYGTGGCCAKAATTGACCWGCCAGAAGGAGAGCATCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link