si:ch211-170d8.5

Ensembl ID:
ENSDARG00000046142
ZFIN ID:
ZDB-GENE-081105-120
Description:
hypothetical protein LOC100000463 [Source:RefSeq peptide;Acc:NP_001107113]
Human Orthologues:
CLEC4A, CLEC4C, CLEC4D, CLEC4E, CLEC6A
Human Descriptions:
C-type lectin domain family 4, member A [Source:HGNC Symbol;Acc:13257]
C-type lectin domain family 4, member C [Source:HGNC Symbol;Acc:13258]
C-type lectin domain family 4, member D [Source:HGNC Symbol;Acc:14554]
C-type lectin domain family 4, member E [Source:HGNC Symbol;Acc:14555]
C-type lectin domain family 6, member A [Source:HGNC Symbol;Acc:14556]
Mouse Orthologues:
Clec4a1, Clec4a2, Clec4a3, Clec4a4, Clec4b1, Clec4b2, Clec4d, Clec4e, Clec4n
Mouse Descriptions:
C-type lectin domain family 4, member a1 Gene [Source:MGI Symbol;Acc:MGI:3036291]
C-type lectin domain family 4, member a2 Gene [Source:MGI Symbol;Acc:MGI:1349412]
C-type lectin domain family 4, member a3 Gene [Source:MGI Symbol;Acc:MGI:1920399]
C-type lectin domain family 4, member a4 Gene [Source:MGI Symbol;Acc:MGI:3624119]
C-type lectin domain family 4, member b1 Gene [Source:MGI Symbol;Acc:MGI:1917060]
C-type lectin domain family 4, member b2 Gene [Source:MGI Symbol;Acc:MGI:3588267]
C-type lectin domain family 4, member d Gene [Source:MGI Symbol;Acc:MGI:1298389]
C-type lectin domain family 4, member e Gene [Source:MGI Symbol;Acc:MGI:1861232]
C-type lectin domain family 4, member n Gene [Source:MGI Symbol;Acc:MGI:1861231]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34457 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067844 Nonsense 124 262 5 8
ENSDART00000135422 Nonsense 132 270 5 8
ENSDART00000147992 Nonsense 100 127 4 5
Genomic Location (Zv9):
Chromosome 8 (position 41689504)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39703084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGGTCATTTCTCTGAACTTGTGATGCAGGTGCCAGTGGCAGAGCAA[G/T]GTTTGTTATTACCAATAAAATAAATAAATTAATTAATTAATAATAGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link