LOC564730

Ensembl ID:
ENSDARG00000046139
Human Orthologues:
CYSLTR1, CYSLTR2
Human Descriptions:
cysteinyl leukotriene receptor 1 [Source:HGNC Symbol;Acc:17451]
cysteinyl leukotriene receptor 2 [Source:HGNC Symbol;Acc:18274]
Mouse Orthologues:
Cysltr1, Cysltr2
Mouse Descriptions:
cysteinyl leukotriene receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1926218]
cysteinyl leukotriene receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1917336]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17533 Nonsense Available for shipment Available now
sa24389 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067836 Nonsense 208 310 1 1
Genomic Location:
Chromosome 23 (position 37156182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTCTTCCTTCTGTRGTCATTTTGGTTTGTTACCCACTCGTGGCCCAT[C/T]GAATCAGCCAAATCAAGAATTCGACCGCCCGTGGAGCTCGAAGGATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067836 Nonsense 221 310 1 1
Genomic Location:
Chromosome 23 (position 37156221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGCCCATCGAATCAGCCAAATCAAGAATTCGACCGCCCGTGGAGCT[C/T]GAAGGATCATTTATGCCATCCTGGCCATCACCATTCTGTGTTTCCTGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m0jpxq2c