BRPF1

Ensembl ID:
ENSDARG00000046136
Description:
bromodomain and PHD finger containing, 1 [Source:HGNC Symbol;Acc:14255]
Human Orthologue:
BRPF1
Human Description:
bromodomain and PHD finger containing, 1 [Source:HGNC Symbol;Acc:14255]
Mouse Orthologue:
Brpf1
Mouse Description:
bromodomain and PHD finger containing, 1 Gene [Source:MGI Symbol;Acc:MGI:1926033]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39525 Nonsense Mutation detected in F1 DNA During 2017
sa24810 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067828 Nonsense 355 1248 3 23
ENSDART00000125388 Nonsense 355 1043 3 18
Genomic Location (Zv9):
Chromosome Zv9_NA994 (position 28318)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 54041067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCGTGCCCTACATCCCCGAGGGCCAGTGGCTGTGCCGCCGCTGCCTG[C/T]AGTCGCCATCCAGAGCTGTCGACTGCGCACTGTGCCCTAACAAGGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067828 Missense 561 1248 4 23
ENSDART00000125388 Essential Splice Site 559 1043 None 18
Genomic Location (Zv9):
Chromosome Zv9_NA994 (position 29096)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 54041845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGCGGAGCGCAGAGCGGCCGCACCCGTGCTGTCTGTGCCCTGCATA[C/T]CACCACACAAGTACAGCAGCACACACACACATGCATTACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link