b3galnt2

Ensembl ID:
ENSDARG00000046133
ZFIN ID:
ZDB-GENE-050522-358
Description:
UDP-GalNAc:beta-1,3-N-acetylgalactosaminyltransferase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q502B3]
Human Orthologue:
B3GALNT2
Human Description:
beta-1,3-N-acetylgalactosaminyltransferase 2 [Source:HGNC Symbol;Acc:28596]
Mouse Orthologue:
B3galnt2
Mouse Description:
UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35598 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067824 Essential Splice Site 133 413 4 10
Genomic Location (Zv9):
Chromosome 13 (position 50785649)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49497437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGCTATATGAAGTTATGCTGATTATTTGAGCTGTTGTTCTTCTGCA[G/A]GGGTTTGAGGGATCTCTGCTCTGGGAAGCTGAGGACTCCACTGCTCTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link