CASKIN1 (1 of 3)

Ensembl ID:
ENSDARG00000046107
Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9831 Essential Splice Site Available for shipment Available now
sa20076 Nonsense Mutation detected in F1 DNA During 2014
sa14718 Nonsense Available for shipment Available now
sa20075 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Essential Splice Site 81 1347 2 21
Genomic Location:
Chromosome 3 (position 35768880)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCAGATCCCCCTGCACCTGGCTGCTCAGCACGGACACTATGACGTGG[T/C]GAGTACACTGTACACACTGCTTCAGCTCCAGACCCGCTGTTCTTCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 830 1347 16 21
Genomic Location:
Chromosome 3 (position 35732068)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGGATGAGCTGAATGTGCCTGATTCAGGAGGAAAATATGCTACAGTA[C/T]AGCCTAGGGTGGGTCGCAGCAACTCAATGAAGGGACAGGCAGACAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 898 1347 16 21
Genomic Location:
Chromosome 3 (position 35731862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAMGTGCCCAAGGAGACTAACAGTGGAYCTCYTCTGGATATTCCCTA[T/A]CAACCACAAAGGCGTGCCAGTGACCTGGGTGGCACTGTAGACACAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 1083 1347 18 21
Genomic Location:
Chromosome 3 (position 35731185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCCGTCCCAAGAGCAAAGACAAAGATGCAGAGGAACTTCAAGATGGA[C/T]AGATGCCTGTACCATATGAGAATGGGACAGGCACAATTAAAAGGCGTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s3jfudgg