si:ch211-283g2.3

Ensembl ID:
ENSDARG00000046092
ZFIN ID:
ZDB-GENE-060526-152
Description:
Novel protein similar to vertebrate asialoglycoprotein receptor 2 (ASGR2) [Source:UniProtKB/TrEMBL;A
Human Orthologues:
CLEC4A, CLEC4C, CLEC4D, CLEC4E, CLEC6A
Human Descriptions:
C-type lectin domain family 4, member A [Source:HGNC Symbol;Acc:13257]
C-type lectin domain family 4, member C [Source:HGNC Symbol;Acc:13258]
C-type lectin domain family 4, member D [Source:HGNC Symbol;Acc:14554]
C-type lectin domain family 4, member E [Source:HGNC Symbol;Acc:14555]
C-type lectin domain family 6, member A [Source:HGNC Symbol;Acc:14556]
Mouse Orthologues:
Clec4a1, Clec4a2, Clec4a3, Clec4a4, Clec4b1, Clec4b2, Clec4d, Clec4e, Clec4n
Mouse Descriptions:
C-type lectin domain family 4, member a1 Gene [Source:MGI Symbol;Acc:MGI:3036291]
C-type lectin domain family 4, member a2 Gene [Source:MGI Symbol;Acc:MGI:1349412]
C-type lectin domain family 4, member a3 Gene [Source:MGI Symbol;Acc:MGI:1920399]
C-type lectin domain family 4, member a4 Gene [Source:MGI Symbol;Acc:MGI:3624119]
C-type lectin domain family 4, member b1 Gene [Source:MGI Symbol;Acc:MGI:1917060]
C-type lectin domain family 4, member b2 Gene [Source:MGI Symbol;Acc:MGI:3588267]
C-type lectin domain family 4, member d Gene [Source:MGI Symbol;Acc:MGI:1298389]
C-type lectin domain family 4, member e Gene [Source:MGI Symbol;Acc:MGI:1861232]
C-type lectin domain family 4, member n Gene [Source:MGI Symbol;Acc:MGI:1861231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6959 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa33522 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100085 Missense 44 131 1 3
ENSDART00000145912 Essential Splice Site 195 280 None 7
Genomic Location (Zv9):
Chromosome 5 (position 4244393)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3904062
KASP Assay ID:
554-5024.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGGCGCATGGCTCTTAAAAATTGAAGATGACTCTGAGGATGAGTGGG[T/A]GCGTAATGAATGTACATAGACACATGGTTTTCCTTATCACAGGGCTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100085 Essential Splice Site 47 131 2 3
ENSDART00000145912 Essential Splice Site 196 280 6 7
Genomic Location (Zv9):
Chromosome 5 (position 4243170)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3902839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTATGTGCCCATTCTGTCTTTAAGTGAGCCTTTGGTCTCTTTTACTA[G/T]CAATTTGTAACTGATTTTGCCAATCCAACTCATTACTGGATCGGCTTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link