dhrs11a

Ensembl ID:
ENSDARG00000046090
ZFIN ID:
ZDB-GENE-060929-324
Description:
dehydrogenase/reductase SDR family member 11 [Source:RefSeq peptide;Acc:NP_001093518]
Human Orthologue:
DHRS11
Human Description:
dehydrogenase/reductase (SDR family) member 11 [Source:HGNC Symbol;Acc:28639]
Mouse Orthologue:
Dhrs11
Mouse Description:
dehydrogenase/reductase (SDR family) member 11 Gene [Source:MGI Symbol;Acc:MGI:2652816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa396 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100097 Nonsense 80 255 2 7
ENSDART00000140537 Nonsense 83 258 2 7
Genomic Location (Zv9):
Chromosome 5 (position 4139333)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3799002
KASP Assay ID:
554-0258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTGATCTGTGCAATGAAGAAGAGATTCTGTCCATGTTTTCCGCCATT[A/T]AGACGCTTCATCAGGGAGTGGACGTGTGCATCAATAACGCCGGTCTGGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link