brd2b

Ensembl ID:
ENSDARG00000046087
ZFIN ID:
ZDB-GENE-070220-1
Description:
bromodomain containing 2b [Source:RefSeq peptide;Acc:NP_001103994]
Human Orthologue:
BRD2
Human Description:
bromodomain containing 2 [Source:HGNC Symbol;Acc:1103]
Mouse Orthologue:
Brd2
Mouse Description:
bromodomain containing 2 Gene [Source:MGI Symbol;Acc:MGI:99495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14579 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049051 Essential Splice Site 412 736 6 10
Genomic Location:
Chromosome 16 (position 52063519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACTACCACGACATCATCAAACACCCCATGGACCTCAGCACTATTAAGG[T/G]ACANCATACATTATWTTAAGGTTGMAMAATGTATCGKTTTAGTATTGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ynk3hd1y