hoxc6b

Ensembl ID:
ENSDARG00000046045
ZFIN ID:
ZDB-GENE-000822-1
Description:
Homeobox protein Hox-C6b [Source:UniProtKB/Swiss-Prot;Acc:Q9PWM5]
Human Orthologue:
HOXC6
Human Description:
homeobox C6 [Source:HGNC Symbol;Acc:5128]
Mouse Orthologue:
Hoxc6
Mouse Description:
homeobox C6 Gene [Source:MGI Symbol;Acc:MGI:96197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067698 Nonsense 138 228 2 2
Genomic Location (Zv9):
Chromosome 11 (position 2149405)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2101858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAATGATCTCTTTCCTCACAGGAGTTGGCTATGGGTCTGACAGACGG[C/T]GAGGTCGCCAAATCTATTCGCGATACCAAACTTTAGAACTTGAGAAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link