hoxc12b

Ensembl ID:
ENSDARG00000046043
ZFIN ID:
ZDB-GENE-000329-17
Description:
Homeobox protein Hox-C12b [Source:UniProtKB/Swiss-Prot;Acc:Q9YGT0]
Human Orthologue:
HOXC12
Human Description:
homeobox C12 [Source:HGNC Symbol;Acc:5124]
Mouse Orthologue:
Hoxc12
Mouse Description:
homeobox C12 Gene [Source:MGI Symbol;Acc:MGI:96194]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21829 Nonsense Available for shipment Available now
sa17786 Nonsense Available for shipment Available now
sa3806 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067696 Nonsense 47 283 1 2
Genomic Location:
Chromosome 11 (position 2180810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGTCGGGGGGACAGCTAGCAGGACTGCAAACCCTCCGCTTATCCAGA[A/T]GAGATAATGTCTGCTCTTTGCCTTGGAACCCATCGGAAGCATGCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067696 Nonsense 156 283 1 2
Genomic Location:
Chromosome 11 (position 2180483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAACGGAGGAAGTTATTCAAAATATGACTGCCTGACACCTGCAGAA[C/T]AGCCWATCCCAAATCCTCGTTTGTGTCGGTCTCTTGAATCGGTTTCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067696 Nonsense 267 283 2 2
Genomic Location:
Chromosome 11 (position 2179877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGCTAAATCTCACGGACCAACAAGTGAAAATCTGGTTCCAAAATCGT[C/T]GAATGAAGAAGAAAAGGCTCTTGATGCGAGAGCAGGCTTTATCTTACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mjczus1d