hoxc12b

Ensembl ID:
ENSDARG00000046043
ZFIN ID:
ZDB-GENE-000329-17
Description:
Homeobox protein Hox-C12b [Source:UniProtKB/Swiss-Prot;Acc:Q9YGT0]
Human Orthologue:
HOXC12
Human Description:
homeobox C12 [Source:HGNC Symbol;Acc:5124]
Mouse Orthologue:
Hoxc12
Mouse Description:
homeobox C12 Gene [Source:MGI Symbol;Acc:MGI:96194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21829 Nonsense Available for shipment Available now
sa17786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067696 Nonsense 47 283 1 2
Genomic Location (Zv9):
Chromosome 11 (position 2180810)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2133263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGTCGGGGGGACAGCTAGCAGGACTGCAAACCCTCCGCTTATCCAGA[A/T]GAGATAATGTCTGCTCTTTGCCTTGGAACCCATCGGAAGCATGCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067696 Nonsense 156 283 1 2
Genomic Location (Zv9):
Chromosome 11 (position 2180483)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2132936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAACGGAGGAAGTTATTCAAAATATGACTGCCTGACACCTGCAGAA[C/T]AGCCWATCCCAAATCCTCGTTTGTGTCGGTCTCTTGAATCGGTTTCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link