im:7154787

Ensembl ID:
ENSDARG00000046010
ZFIN ID:
ZDB-GENE-080225-13
Description:
Im:7154787 protein [Source:UniProtKB/TrEMBL;Acc:Q05AK2]
Human Orthologue:
KDM2B
Human Description:
lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610]
Mouse Orthologue:
Kdm2b
Mouse Description:
lysine (K)-specific demethylase 2B Gene [Source:MGI Symbol;Acc:MGI:1354737]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41732 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102530 Nonsense 12 405 1 5
Genomic Location (Zv9):
Chromosome 10 (position 43202224)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41915525
GRCz10 10 42009546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAAAAAGCCAGCGAAAACCCAAACGTAAACCTCGACTGCCCAATAAA[G/T]AACTGAGTAAAGAGCTGAGCAAACAACTGAACCAGGAGATCCAAAAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link