PLA2G4C (3 of 5)

Ensembl ID:
ENSDARG00000045982
Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Human Orthologue:
PLA2G4C
Human Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Mouse Orthologue:
Pla2g4c
Mouse Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) Gene [Source:MGI Symbol;Acc:MGI:1196403

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11000 Nonsense Available for shipment Available now
sa6960 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067596 Nonsense 36 563 1 18
Genomic Location (Zv9):
Chromosome 5 (position 4522893)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4172736
KASP Assay ID:
2259-5376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAATATGAAGGAGGCRGCRTGTGTGAAAAAAAGGAGAAGTGAAATCT[G/A]GTCAAGCCTGAAAACACTTGGTATAAACTGTAGTCAGGTTAGTCTAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067596 Nonsense 421 563 16 18
Genomic Location (Zv9):
Chromosome 5 (position 4538869)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4188059
KASP Assay ID:
554-5340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATCCTGCAGTTCCYGCTGCTCTTCTGAAARGTRAAACSAGAGACTA[T/A]GAAGATGCTGGACTGTTGCTGAACTCACCCTAYTTCTCTGTGCTGAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link