olfcg8

Ensembl ID:
ENSDARG00000045973
ZFIN ID:
ZDB-GENE-081030-12
Description:
Novel odorant receptor protein [Source:UniProtKB/TrEMBL;Acc:B8JIF4]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24955 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067568 Essential Splice Site 412 831 4 6
ENSDART00000143266 Essential Splice Site 415 834 4 6
Genomic Location (Zv9):
Chromosome 14 (position 17618631)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32730896
KASP Assay ID:
554-7865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAAGGCCACAGTGATAACAAACCGTAATGCTTCTTTTTTATTTATTT[A/G]GTTGGTCGAGGCTCTAAGAAAGGTGAATTTCACCGTAAAGATGGGCGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link